Usage¶
Basic workflow¶
- Prepare a FASTA file with your target sequence.
- Register a reference genome with
fetchMouseIndexorbuildGenomeIndex. - Run
listReferencesto confirm the genome is installed and see available species. - Run
designProbes(single record) ordesignProbesBatch(multi-record). - Review the TSV output and optional IDT ordering sheet.
- Optionally inspect the Bowtie2 SAM file produced during genome masking.
Example FASTA¶
>MyTarget
ACGTACGTACGTACGTACGTACGTACGTACGT
Single-record probe design¶
Before running, register a species or provide --index (or skip genome masking with --no-genomemask).
designProbes targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idt
Batch probe design¶
designProbesBatch targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idt
Override channel per record¶
Add channel= to the FASTA header:
>MyTarget channel=B2
ACGTACGTACGTACGTACGTACGT