Usage¶

Basic workflow¶

1. Prepare a FASTA file with your target sequence.
2. Register a reference genome with fetchMouseIndex or buildGenomeIndex.
3. Run designProbes (single record) or designProbesBatch (multi-record).
4. Review the TSV output and optional IDT ordering sheet.
5. Optionally inspect the Bowtie2 SAM file produced during genome masking.

Example FASTA¶

>MyTarget
ACGTACGTACGTACGTACGTACGTACGTACGT

Single-record probe design¶

Before running, register a species or provide --index (or skip genome masking with --no-genomemask).

designProbes targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idt

Batch probe design¶

designProbesBatch targets.fa --species mouse --channel B1 --output probes.tsv --idt probes.idt

Override channel per record¶

Add channel= to the FASTA header:

>MyTarget channel=B2
ACGTACGTACGTACGTACGTACGT